majesticfart5647 majesticfart5647

25-05-2023
Mathematics

contestada

Consider the linear system az + 2y + = 4
x-2y+2x=2a
ax+3y+z=2
For what value(s) of a the system has no solution? a) -1 b) - 1/2 c) 1/2 d) R - (1)

Respuesta :

Otras preguntas

how can I solve this question ? wick method should I use ?

The statement of cash flows will not report the Group of answer choices amount of checks outstanding at the end of the period. sources of cash in the current pe

What is the range of the given data set? 2, 5, 19, 7,-5, 33, 26, 15, 12 27 28 38

in ΔABC, ∠ABC is a right angle, AB = 3 units, and BC = 2 units. ΔABC is dilated by a scale factor of 0.5 with point B as the center of dilation, resulting in th

evaluate the extent to which nationalism contributed to the collapse of the ottoman empire in the early twentieth century. (I need answers with documents)

Can you figure out what the area of this shape is?

Watch for oncoming sandstorms by checking the horizon for what appears to be a _______ moving along the surface of the terrain.

The rhinestones in costume jewelry are glass with index of refraction 1.50. To make them more reflective, they are often coated with a layer of silicon monoxide

You receive $10,000 now for an investment that will give you cash flows of $1000 in one year, $2000 in two years, $3000 in three years, and $4000 in four years.

Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first C): ATGCTGCGAAACTTTGGCTGA Provid