Nanagirly Nanagirly
  • 22-12-2022
  • Mathematics
contestada

Can someone help please? Picture is already attached. If its wrong please correct it. This isn’t mine by the way, I’m posting it for someone else.

Can someone help please Picture is already attached If its wrong please correct it This isnt mine by the way Im posting it for someone else class=

Respuesta :

Otras preguntas

o which of the senses does the author appeal in describing Old Lady Chong in the story two-kinds?
Please help me with this worksheet
BRAINLIEST FOR BEST ANSWER!!! What are the similarities and differences between these data sets in terms of their centers and their variability? Data Set A: 16
for a recipe,the ratio of broccoli to carrots is 3:2. If there are 9 ounces of broccoli , how many ounces of carrots are there ?
A weather plane took to the skies to measure the speed of the jet stream. The plane flew 1920 km with the jet stream as a tail wind. Then, it returned to its or
How did the 13 colonies cut their ties with britain?
Why is canada the top trading partner for the united states?
4. How many molecules are equal to 2.25 moles of sulfur dioxide?
What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataatt
Based on what you have read about Suarez Farms, what are the costs and benefits of growing organic vegetables? Check all that apply