chlo4413 chlo4413

24-11-2022
Computers and Technology

contestada

Question 1 computer 1 on network b, with ip address of 192. 168. 1. 233, wants to send a packet to computer 2, with ip address of 10. 1. 1. 205. On which network is computer 2?.

Respuesta :

Otras preguntas

what are the 3 care instructions for future life on earth

The radius of the planent venus is nearly the same as that of the earth,but its mass is only eighty percent that of the earth. If an object weighs w on the eart

if probability of a win is 0.24 and the probability of a draw Is 0.16, what is the probability of a loss

Work out the Hcf of 32 and 36

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

Where does the water in streams and rivers originate? a. precipitation b. runoff c. ice and snowpacks d. all of the above

the combined land area of the countries A and B is 147,973 square kilometers. Country A is larger by 673 square kilometers. Determine the land area of each coun

what type of sentence tends to express a strong emotion

Complete the second sentence so that it has a similar meaning to the first sentence. Use the word in bold if given.

which branch of central government makes/enact/ passes laws